WormMine: Gene WBGene00127428

• WormBase Gene ID: WBGene00127428
• Gene Name: CJA08224
• Sequence Name: CJA08224
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans C27D8.1; F53C3.1; and Y39G8C.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA08224a.1	CJA08224a.1		[unknown]
Transcript:CJA08224b.1	CJA08224b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA08224b	CJA08224b		[unknown]
CDS:CJA08224a	CJA08224a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1072955
• Remark: CJA08224, AATTGTTCAGAGGGATACGCAGAGCCAAAGAGTTGCACTTGTTCATGGATTACATTGACT, WBGene00127428
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region