WormMine: Gene WBGene00127642

• WormBase Gene ID: WBGene00127642
• Gene Name: Cjp-snrp-3
• Sequence Name: CJA08436
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable nucleic acid binding activity and zinc ion binding activity. Predicted to be involved in spliceosomal snRNP assembly. Predicted to be part of U1 snRNP. Is an ortholog of C. elegans snrp-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA08436.1	CJA08436.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA08436	CJA08436		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1091416
• Remark: CJA08436, AGTGCCACGCACCACAATAGGAATGCCGGCCGTGCCGCCCGTTCACCCCATGATGGGCGG, WBGene00127642
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region