WormMine: Gene WBGene00127655

• WormBase Gene ID: WBGene00127655
• Gene Name: Cjp-hst-1
• Sequence Name: CJA08451
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable [heparan sulfate]-glucosamine N-sulfotransferase activity and hydrolase activity. Is an ortholog of C. elegans hst-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA08451a.1	CJA08451a.1		[unknown]
Transcript:CJA08451b.1	CJA08451b.1		[unknown]
Transcript:CJA08451c.1	CJA08451c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA08451b	CJA08451b		[unknown]
CDS:CJA08451c	CJA08451c		[unknown]
CDS:CJA08451a	CJA08451a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1089473
• Remark: Cjp-hst-1, GGCTCCGAAACAAGCGTCTTCGCTTATTCCGAACACAAAACTCGTGGTTATTCTTCAGAA, WBGene00127655
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region