WormMine: Gene WBGene00127671

• WormBase Gene ID: WBGene00127671
• Gene Name: Cjp-ctbp-1
• Sequence Name: CJA08467
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable NAD binding activity and oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor. Is an ortholog of C. elegans ctbp-1. In C. elegans, ctbp-1 is involved in negative regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA08467c.1	CJA08467c.1		[unknown]
Transcript:CJA08467a.1	CJA08467a.1		[unknown]
Transcript:CJA08467b.1	CJA08467b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA08467a	CJA08467a		[unknown]
CDS:CJA08467b	CJA08467b		[unknown]
CDS:CJA08467c	CJA08467c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1071739
• Remark: Cjp-ctbp-1, TATTAACGGTAGATGCCCTCAAGATTTAACCCATTGCATCAATAAAGAAGCAGTTATGCG, WBGene00127671
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region