WormMine: Gene WBGene00127799

• WormBase Gene ID: WBGene00127799
• Gene Name: Cjp-dnc-2
• Sequence Name: CJA08595
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in microtubule-based process. Predicted to be part of dynactin complex. Is an ortholog of C. elegans dnc-2. In C. elegans, dnc-2 is involved in chromosome segregation; establishment of mitotic spindle orientation; and single fertilization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA08595.1	CJA08595.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA08595	CJA08595		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1086805
• Remark: Cjp-dnc-2, AATGGGACGTCACGTGCTCATCTCTACCGAGCAATGTGAACAAAGTGAAAGCGTTGAACA, WBGene00127799
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region