WormMine: Gene WBGene00127916

• WormBase Gene ID: WBGene00127916
• Gene Name: CJA08712
• Sequence Name: CJA08712
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ubiquitin protein ligase binding activity. Predicted to be involved in ubiquitin-dependent protein catabolic process. Is an ortholog of C. elegans F43E2.1 and cul-4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA08712a.1	CJA08712a.1		[unknown]
Transcript:CJA08712c.1	CJA08712c.1		[unknown]
Transcript:CJA08712b.1	CJA08712b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA08712c	CJA08712c		[unknown]
CDS:CJA08712b	CJA08712b		[unknown]
CDS:CJA08712a	CJA08712a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1083072
• Remark: CJA08712, CCGTATGATAAAATGAATCCGGCGAGAAGTGCAAGAACGTCGCACGAGTTTATTGGAGCG, WBGene00127916
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region