WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00128013 Gene Name  Cjp-hst-3.2
Sequence Name  ? CJA08810 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable sulfotransferase activity. Is an ortholog of C. elegans hst-3.2. In C. elegans, hst-3.2 is involved in heparan sulfate proteoglycan biosynthetic process. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA08810b.1 CJA08810b.1   [unknown]
Transcript:CJA08810a.1 CJA08810a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA08810a CJA08810a   [unknown]
CDS:CJA08810b CJA08810b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-hst-3.2, GACGAGAGGCGTGAATTCTGGATGGGGAGCCATCAGAATAGGAGTATATCACAAACACAT, WBGene00128013   Expr1081667 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region