WormMine: Gene WBGene00128107

• WormBase Gene ID: WBGene00128107
• Gene Name: Cjp-cdd-2
• Sequence Name: CJA08902
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable cytidine deaminase activity and zinc ion binding activity. Predicted to be involved in cytidine deamination. Is an ortholog of C. elegans cdd-2. In C. elegans, cdd-2 is involved in RNA modification; embryo development; and pyrimidine nucleoside metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA08902.1	CJA08902.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA08902	CJA08902		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1088361
• Remark: Cjp-cdd-2, TTGAACTTCTTCCTTACGCTTTCACTCCCGAATCGCTCGATACATTCGAGCAAGAAAAAG, WBGene00128107
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region