WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00128280 Gene Name  CJA09076
Sequence Name  ? CJA09076 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable nucleic acid binding activity. Predicted to be involved in DNA integration. Is an ortholog of C. elegans K02F6.1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA09076.1 CJA09076.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA09076 CJA09076   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

5 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA05797, TGGAAAAGTCAAGTATCGTGTGGAATGCAATGGACAGTTATGGGATCGTCATGCCAACCA, WBGene00125001   Expr1083796 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA04219, AATCAACACACATCTGGGACTCTTCTACCCAAATCGACTACCATATGGAGTGAAAAGCGC, WBGene00123423   Expr1078782 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA11365, CGGATCCTACAATCACCGCCGTAATCAAATATGTACGAGATGGAAATTGGCCAAAACTTG, WBGene00130569   Expr1076872 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA22115, TCATCGCAAGTGTGGAAGCGGATCTGGATGCAGAACATCGTGGAATCATCAACAATCTAC, WBGene00177687   Expr1077530 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA04123, ATCCAAGGCGGATCCTACAATCACCGCCGTAATCAAATATGTACGAGATGGAAATTGGCC, WBGene00123328   Expr1080489 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  involved_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region