WormMine: Gene WBGene00128319

• WormBase Gene ID: WBGene00128319
• Gene Name: Cjp-gar-3
• Sequence Name: CJA09115
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable G protein-coupled acetylcholine receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in plasma membrane. Is an ortholog of C. elegans gar-3. In C. elegans, gar-3 is involved in several processes, including G protein-coupled acetylcholine receptor signaling pathway; positive regulation of acetylcholine secretion, neurotransmission; and positive regulation of protein localization to synapse.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09115a.1	CJA09115a.1		[unknown]
Transcript:CJA09115b.1	CJA09115b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09115b	CJA09115b		[unknown]
CDS:CJA09115a	CJA09115a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1086938
• Remark: Cjp-gar-3, ATTCCGTCACACCTACATGAGAATTCTGCGCTGTAAGTTCAAAGCGGAACGGCCAACAAT, WBGene00128319
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region