WormMine: Gene WBGene00128325

• WormBase Gene ID: WBGene00128325
• Gene Name: CJA09121
• Sequence Name: CJA09121
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable (d)CMP kinase activity; ATP binding activity; and UMP/dUMP kinase activity. Predicted to be involved in 'de novo' pyrimidine nucleobase biosynthetic process and pyrimidine nucleotide biosynthetic process. Is an ortholog of C. elegans C29F7.3. In C. elegans, C29F7.3 is involved in UDP biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09121.1	CJA09121.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09121	CJA09121		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1086329
• Remark: CJA09121, TTCCCAATTATTGAACAGTATGAGAAACATGGAATGGTCCGTGAGGTTAATAGTCAACGG, WBGene00128325
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region