WormMine: Gene WBGene00128514

• WormBase Gene ID: WBGene00128514
• Gene Name: Cjp-aex-2
• Sequence Name: CJA09311
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable neuropeptide receptor activity. Predicted to be involved in neuropeptide signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans aex-2. In C. elegans, aex-2 is involved in several processes, including lipid transport involved in lipid storage; positive regulation of digestive system process; and positive regulation of triglyceride transport.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09311.1	CJA09311.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09311	CJA09311		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1072776
• Remark: Cjp-aex-2, GCATCAGTTTGGGACTCATTTTTGGTCGGTTACGTGAGAACAGCTCAACAGAGGTGCTAA, WBGene00128514
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region