WormMine: Gene WBGene00128539

• WormBase Gene ID: WBGene00128539
• Gene Name: Cjp-unc-33
• Sequence Name: CJA09335
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds. Is an ortholog of C. elegans unc-33. In C. elegans, unc-33 is involved in several processes, including axon guidance; establishment or maintenance of cytoskeleton polarity; and regulation of locomotion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09335b.1	CJA09335b.1		[unknown]
Transcript:CJA09335a.1	CJA09335a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09335b	CJA09335b		[unknown]
CDS:CJA09335a	CJA09335a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1088961
• Remark: Cjp-unc-33, AAAGGCGGCGAATTCAATAGGAACCGACAAAACGTGATGGAGTCGTCGATCGATTTTGGA, WBGene00128539
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region