WormMine: Gene WBGene00128950

• WormBase Gene ID: WBGene00128950
• Gene Name: CJA09746
• Sequence Name: CJA09746
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable DNA binding activity and G protein-coupled receptor activity. Predicted to be involved in DNA integration; DNA transposition; and G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans ZK1307.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09746a.1	CJA09746a.1		[unknown]
Transcript:CJA09746b.1	CJA09746b.1		[unknown]
Transcript:CJA09746c.1	CJA09746c.1		[unknown]
Transcript:CJA09746d.1	CJA09746d.1		[unknown]
Transcript:CJA09746e.1	CJA09746e.1		[unknown]

Other

5 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09746d	CJA09746d		[unknown]
CDS:CJA09746e	CJA09746e		[unknown]
CDS:CJA09746b	CJA09746b		[unknown]
CDS:CJA09746c	CJA09746c		[unknown]
CDS:CJA09746a	CJA09746a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1077122
• Remark: CJA04551, GACAAAGAGTCGTTGCTCTCCGAGAACATTCGCCCGCTGTACACCCTGTCATCGGATCTT, WBGene00123753
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region