WormMine: Gene WBGene00129133

• WormBase Gene ID: WBGene00129133
• Gene Name: Cjp-uba-2
• Sequence Name: CJA09929
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable SUMO activating enzyme activity. Predicted to be involved in protein sumoylation. Is an ortholog of C. elegans uba-2. In C. elegans, uba-2 is involved in several processes, including anterior/posterior pattern specification; nematode larval development; and protein sumoylation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09929.1	CJA09929.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09929	CJA09929		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1088653
• Remark: Cjp-uba-2, CTGTCTTTCGAAAAGGATGAGCCCACTATCATGGCTTTTGTGGCAGCTGTCGCCAATATT, WBGene00129133
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region