WormMine: Gene WBGene00129148

• WormBase Gene ID: WBGene00129148
• Gene Name: Cjp-enol-1
• Sequence Name: CJA09944
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable magnesium ion binding activity and phosphopyruvate hydratase activity. Predicted to be involved in glycolytic process. Predicted to be part of phosphopyruvate hydratase complex. Is an ortholog of C. elegans enol-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09944.1	CJA09944.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09944	CJA09944		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1077779
• Remark: Cjp-enol-1, GTCAACCAGATTGGATCGGTCACCGAGTCGATCGAGGCTGCCAAGCTCTCCCGTGCTAAC, WBGene00129148
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region