WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00129248 Gene Name  Cjp-gon-14
Sequence Name  ? CJA10044 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable protein dimerization activity. Predicted to be involved in negative regulation of vulval development. Is an ortholog of C. elegans gon-14. In C. elegans, gon-14 is involved in several processes, including gonad morphogenesis; negative regulation of vulval development; and system process. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA10044a.1 CJA10044a.1   [unknown]
Transcript:CJA10044b.1 CJA10044b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA10044a CJA10044a   [unknown]
CDS:CJA10044b CJA10044b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA10044, ATCACCACAATCGTCACGGGAAAAGCAGAGTTTGAAGAGGCGCTAGAAGATATCGGATCG, WBGene00129248   Expr1071188 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA15861, CAATTGTGAACGGAAATTCGACAGCCCAGAAAACATATTTCGTTCGGAAACGGACCGGTC, WBGene00135065   Expr1076266 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  involved_in
  enables

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region