WormMine: Gene WBGene00129420

• WormBase Gene ID: WBGene00129420
• Gene Name: Cjp-vha-9
• Sequence Name: CJA10216
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable proton-transporting ATPase activity, rotational mechanism. Predicted to be involved in proton transmembrane transport. Predicted to be part of proton-transporting V-type ATPase, V1 domain. Is an ortholog of C. elegans vha-9. In C. elegans, vha-9 is involved in lysosomal lumen acidification.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA10216.1	CJA10216.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA10216	CJA10216		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1087180
• Remark: Cjp-vha-9, CAACACACCCAATCAATTCCAGCTGTGCTCGAAATCCCATCCAAAGAAGCTCCGTACGAT, WBGene00129420
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region