WormMine: Gene WBGene00129436

• WormBase Gene ID: WBGene00129436
• Gene Name: CJA10232
• Sequence Name: CJA10232
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable acyltransferase activity, transferring groups other than amino-acyl groups. Is an ortholog of C. elegans oac-59; oac-58; and oac-57.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA10232a.1	CJA10232a.1		[unknown]
Transcript:CJA10232c.1	CJA10232c.1		[unknown]
Transcript:CJA10232b.1	CJA10232b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA10232a	CJA10232a		[unknown]
CDS:CJA10232c	CJA10232c		[unknown]
CDS:CJA10232b	CJA10232b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081053
• Remark: Cjp-oac-12, TATGAAATTGGAAGAATGCGACATGCGGCCCTTGTAGAAGAGTGTGGCCCAAAGTGCGAA, WBGene00129436
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region