WormMine: Gene WBGene00129807

• WormBase Gene ID: WBGene00129807
• Gene Name: Cjp-alh-13
• Sequence Name: CJA10603
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity; glutamate-5-semialdehyde dehydrogenase activity; and kinase activity. Predicted to be involved in proline biosynthetic process. Predicted to be located in cytoplasm. Is an ortholog of C. elegans alh-13.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA10603b.1	CJA10603b.1		[unknown]
Transcript:CJA10603a.1	CJA10603a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA10603b	CJA10603b		[unknown]
CDS:CJA10603a	CJA10603a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081367
• Remark: CJA10603, TGGAAAATACACTTACCTCCATGAGAACCTCAACCCAAGCGAAATCTTCAGAGCACTGGA, WBGene00129807
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

8 GO Annotation

0 Homologues

0 Locations

8 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region