WormMine: Gene WBGene00129884

• WormBase Gene ID: WBGene00129884
• Gene Name: Cjp-moc-5
• Sequence Name: CJA10680
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable 4 iron, 4 sulfur cluster binding activity; catalytic activity; and metal ion binding activity. Predicted to be involved in Mo-molybdopterin cofactor biosynthetic process. Is an ortholog of C. elegans moc-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA10680.1	CJA10680.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA10680	CJA10680		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081757
• Remark: CJA10680, TTAAAGGACAGTTTGGGTTCATCACTTCTATGACAGACCATTTTTGTAACACGTGCAACC, WBGene00129884
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region