WormMine: Gene WBGene00129965

• WormBase Gene ID: WBGene00129965
• Gene Name: Cjp-zak-1
• Sequence Name: CJA10761
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans zak-1. In C. elegans, zak-1 is involved in stress-activated MAPK cascade.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA10761b.1	CJA10761b.1		[unknown]
Transcript:CJA10761a.1	CJA10761a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA10761a	CJA10761a		[unknown]
CDS:CJA10761b	CJA10761b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070595
• Remark: Cjp-zak-1, CGTGCTCGCCGAGTTCACGTGCATGGCGGAAAAGACAAGTGGAATTGGAAGAAGGGAAAA, WBGene00129965
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region