WormMine: Gene WBGene00130000

• WormBase Gene ID: WBGene00130000
• Gene Name: Cjp-sur-6
• Sequence Name: CJA10796
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable protein phosphatase regulator activity. Predicted to be part of protein phosphatase type 2A complex. Is an ortholog of C. elegans sur-6. In C. elegans, sur-6 is involved in embryo development; nematode larval development; and positive regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA10796.2	CJA10796.2		[unknown]
Transcript:CJA10796.1	CJA10796.1		[unknown]
Transcript:CJA10796.4	CJA10796.4		[unknown]
Transcript:CJA10796.3	CJA10796.3		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA10796	CJA10796		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1085058
• Remark: Cjp-sur-6, AAATCAGCAAGGAGCCGATGCGAAGACGTGGGAGGCGAGACCACAAGAGCCACATTCGAA, WBGene00130000
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region