WormMine: Gene WBGene00130097

• WormBase Gene ID: WBGene00130097
• Gene Name: Cjp-erd-2.1
• Sequence Name: CJA10893
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ER retention sequence binding activity. Predicted to be involved in protein retention in ER lumen. Predicted to be located in membrane. Is an ortholog of C. elegans erd-2.1. In C. elegans, erd-2.1 is involved in IRE1-mediated unfolded protein response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA10893.1	CJA10893.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA10893	CJA10893		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1082410
• Remark: Cjp-erd-2, GCACCGGAAACGCCGAAACCATCACTGCTCACTATCTGTTCGCCCTTGGTTCCTACAGAT, WBGene00130097
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region