WormMine: Gene WBGene00130529

• WormBase Gene ID: WBGene00130529
• Gene Name: Cjp-lst-4
• Sequence Name: CJA11325
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable phosphatidylinositol binding activity. Predicted to be involved in mitotic cell cycle and protein transport. Is an ortholog of C. elegans lst-4. In C. elegans, lst-4 is involved in execution phase of apoptosis and phagosome-lysosome fusion involved in apoptotic cell clearance.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA11325b.1	CJA11325b.1		[unknown]
Transcript:CJA11325a.1	CJA11325a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA11325a	CJA11325a		[unknown]
CDS:CJA11325b	CJA11325b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081716
• Remark: Cjp-lst-4, GAGGGCAGGCTCTCACCTGCCGAAGCTGAAAAGATGAAACAGCGCATTGATGTGATGAGC, WBGene00130529
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region