WormMine: Gene WBGene00130550

• WormBase Gene ID: WBGene00130550
• Gene Name: Cjp-ift-81
• Sequence Name: CJA11346
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable tubulin binding activity. Predicted to be involved in cilium assembly and intraciliary transport. Predicted to be part of intraciliary transport particle B. Is an ortholog of C. elegans ift-81. In C. elegans, ift-81 is involved in chemotaxis; detection of stimulus involved in sensory perception; and intraciliary transport.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA11346.1	CJA11346.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA11346	CJA11346		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1078117
• Remark: Cjp-ift-81, ATAGTAGAAGTTCTGAATGTTCCACAGAAATTCGATCGTCCAAAAACCGCTGCTCCACAA, WBGene00130550
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region