Genomics
2 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CJA11367b.1 | CJA11367b.1 | [unknown] | |
Transcript:CJA11367a.1 | CJA11367a.1 | [unknown] |
Other
2 CDSs
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
CDS:CJA11367b | CJA11367b | [unknown] | |
CDS:CJA11367a | CJA11367a | [unknown] |
2 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
Cjp-itr-1, ACTGGTCCTGAAAGTTATGTGGCACAATGTGTTAAAGAAAGGAATTTGGATTGGTTCCCC, WBGene00130571 | Expr1085273 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
CJA24695, AAATCCAGGTTTGTGTGGTTCGATGATTTGTTTGCAGTGATCAGATACATACATATCAGT, WBGene00180267 | Expr1088983 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
10 GO Annotation
Annotation Extension | Qualifier |
---|---|
enables | |
enables | |
involved_in | |
involved_in | |
involved_in | |
involved_in | |
located_in | |
located_in | |
enables | |
enables |