WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00130634 Gene Name  Cjp-cyk-4
Sequence Name  ? CJA11430 Organism  Caenorhabditis japonica
Automated Description  Predicted to be involved in signal transduction. Is an ortholog of C. elegans cyk-4. In C. elegans, cyk-4 is involved in mitotic cleavage furrow ingression; mitotic spindle midzone assembly; and polar body extrusion after meiotic divisions. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA11430.1 CJA11430.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA11430 CJA11430   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-cyk-4, AGCAATGTCCGACAGAAACAAGATGAACTTGGATAATATGGCACGAGTTTTGGCGCCTTG, WBGene00130634   Expr1084822 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  involved_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region