WormMine: Gene WBGene00130752

• WormBase Gene ID: WBGene00130752
• Gene Name: Cjp-daf-14
• Sequence Name: CJA11548
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans daf-14. In C. elegans, daf-14 is involved in several processes, including determination of adult lifespan; egg-laying behavior; and negative regulation of dauer larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA11548a.1	CJA11548a.1		[unknown]
Transcript:CJA11548b.1	CJA11548b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA11548b	CJA11548b		[unknown]
CDS:CJA11548a	CJA11548a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1077399
• Remark: Cjp-daf-14, GTACAATCATCGACAATCCATGCTGGGTAGAGATTCATTTTACCGAGCCTTACGAGTTAA, WBGene00130752
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region