WormMine: Gene WBGene00130759

• WormBase Gene ID: WBGene00130759
• Gene Name: Cjp-pfk-1.1
• Sequence Name: CJA11555
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable 6-phosphofructokinase activity and ATP binding activity. Predicted to be involved in fructose 6-phosphate metabolic process and glycolytic process. Predicted to be located in cytoplasm. Is an ortholog of C. elegans pfk-1.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA11555.1	CJA11555.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA11555	CJA11555		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1085542
• Remark: CJA11555, ATATGAAAGTTCTGCTATTTTAGAGTCAGTCGAGGAGGTGGAAGAGGATACCCATATGTT, WBGene00130759
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region