WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00130810 Gene Name  Cjp-cgef-1
Sequence Name  ? CJA11606 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable guanyl-nucleotide exchange factor activity. Is an ortholog of C. elegans cgef-1. In C. elegans, cgef-1 is involved in protein localization. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA11606.1 CJA11606.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA11606 CJA11606   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA22709, CTTCCTAATGATGCCGACAGTACCGCTCGAATACTTGAGTTGCAGACTGCAGAAAAAATG, WBGene00178281   Expr1084588 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA16814, GCAAGTATATCCACGGAGAGCATCTGACAATGGACGTCGGTGGTCTTATCAAGTACAATC, WBGene00136018   Expr1070365 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-tag-150, GATACAACGCCGTTGAGAACAGCCGAAATCAACAACGAAGTCGAGCTGGTGGACAGTTGT, WBGene00130810   Expr1079605 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region