WormMine: Gene WBGene00121851

• WormBase Gene ID: WBGene00121851
• Gene Name: Cjp-pcs-1
• Sequence Name: CJA02647
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable glutathione gamma-glutamylcysteinyltransferase activity and metal ion binding activity. Predicted to be involved in phytochelatin biosynthetic process and response to metal ion. Is an ortholog of C. elegans pcs-1. In C. elegans, pcs-1 is involved in detoxification of inorganic compound and phytochelatin biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA02647.1	CJA02647.1		[unknown]
Transcript:CJA02647.2	CJA02647.2		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA02647	CJA02647		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1076136
• Remark: Cjp-pcs-1, CGTTCGAGCACGGATTTAGTGAACGTAGCGATCGAATTGGAAATTTGGCTAGCGAGTATA, WBGene00121851
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region