WormMine: Gene WBGene00130940

• WormBase Gene ID: WBGene00130940
• Gene Name: Cjp-vab-3
• Sequence Name: CJA11736
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans vab-3. In C. elegans, vab-3 is involved in several processes, including male anatomical structure morphogenesis; negative regulation of distal tip cell migration; and positive regulation of glial cell differentiation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA11736a.1	CJA11736a.1		[unknown]
Transcript:CJA11736b.1	CJA11736b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA11736b	CJA11736b		[unknown]
CDS:CJA11736a	CJA11736a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070698
• Remark: Cjp-ceh-8, AATCGCTGAGCCACAGTCAGATGCACGAACTCGGCGATATCTCGCAAGCACATGAACACT, WBGene00130940
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region