WormMine: Gene WBGene00130949

• WormBase Gene ID: WBGene00130949
• Gene Name: Cjp-sup-18
• Sequence Name: CJA11745
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable oxidoreductase activity. Is an ortholog of C. elegans sup-18.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA11745b.1	CJA11745b.1		[unknown]
Transcript:CJA11745a.1	CJA11745a.1		[unknown]
Transcript:CJA11745c.1	CJA11745c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA11745a	CJA11745a		[unknown]
CDS:CJA11745b	CJA11745b		[unknown]
CDS:CJA11745c	CJA11745c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1072938
• Remark: CJA11745, GACGTCATGGTGCCAGATCTCAAACGGAAACCGGTTGAACATATCACAAAACTCTACTGA, WBGene00130949
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region