WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00131083 Gene Name  Cjp-unc-16
Sequence Name  ? CJA11879 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable MAP-kinase scaffold activity. Is an ortholog of C. elegans unc-16. In C. elegans, unc-16 is involved in several processes, including defecation; egg-laying behavior; and regulation of JNK cascade. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA11879.1 CJA11879.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA11879 CJA11879   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA03494, AAATTCCAAGAGCAATCGGAAATGCAGCTGGAAGTGTTGGAGATGCGCTGGGACAAGTGG, WBGene00122698   Expr1084840 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-unc-16, ACGTGACATGTCTCATCTAATAATTTGGGAAATTGATGCGGAACTTCCGATTCTCTCAAA, WBGene00131083   Expr1072350 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA28381, TCTTGATGGAAAAACGGCGACCGATGAGGAGAAACAACTCGACATTCGTCACAAATTGTA, WBGene00183955   Expr1074181 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region