WormMine: Gene WBGene00131234

• WormBase Gene ID: WBGene00131234
• Gene Name: Cjp-gcy-6
• Sequence Name: CJA12030
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity; guanylate cyclase activity; and protein kinase activity. Predicted to be involved in cGMP biosynthetic process and intracellular signal transduction. Is an ortholog of C. elegans gcy-6. In C. elegans, gcy-6 is involved in several processes, including positive regulation of calcium-mediated signaling; response to magnesium ion; and response to salt.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12030c.1	CJA12030c.1		[unknown]
Transcript:CJA12030b.1	CJA12030b.1		[unknown]
Transcript:CJA12030a.1	CJA12030a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12030c	CJA12030c		[unknown]
CDS:CJA12030b	CJA12030b		[unknown]
CDS:CJA12030a	CJA12030a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1086543
• Remark: Cjp-gcy-6, GATTTCAGAGTTCCACACATGCCTGCTGAGCGTATCAAGATTCGAGTGGGATTTCATTGC, WBGene00131234
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region