WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00131364 Gene Name  CJA12160
Sequence Name  ? CJA12160 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable calcium ion binding activity. Is an ortholog of C. elegans pat-10. In C. elegans, pat-10 is involved in embryo development; muscle contraction; and skeletal muscle thin filament assembly. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA12160.3 CJA12160.3   [unknown]
Transcript:CJA12160.2 CJA12160.2   [unknown]
Transcript:CJA12160.4 CJA12160.4   [unknown]
Transcript:CJA12160.1 CJA12160.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA12160 CJA12160   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-pat-10, CACGACCAACTCTGAAGGCTCTTCTCAAGGAGATCGCCGACGACCTTACCGATCAACAAC, WBGene00131364   Expr1089767 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region