WormMine: Gene WBGene00131439

• WormBase Gene ID: WBGene00131439
• Gene Name: CJA12235
• Sequence Name: CJA12235
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable calcium ion binding activity. Predicted to be involved in homophilic cell adhesion via plasma membrane adhesion molecules. Predicted to be located in membrane. Is an ortholog of C. elegans cdh-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12235.1	CJA12235.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12235	CJA12235		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1071463
• Remark: CJA12235, CACAATTCGAAAAAGCCCTGTGGCAAGTGGAAATCGCAGAGGACACTCCAGTTGGCACGT, WBGene00131439
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region