WormMine: Gene WBGene00131492

• WormBase Gene ID: WBGene00131492
• Gene Name: CJA12288
• Sequence Name: CJA12288
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans C56C10.6 and F54H5.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12288a.1	CJA12288a.1		[unknown]
Transcript:CJA12288b.1	CJA12288b.1		[unknown]
Transcript:CJA12288c.1	CJA12288c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12288c	CJA12288c		[unknown]
CDS:CJA12288a	CJA12288a		[unknown]
CDS:CJA12288b	CJA12288b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1078720
• Remark: CJA12288, TTTTTCAGATAGGATTCATCCATCGCGATCTTAAACCTGCAAACATGGCTCTAGGATACA, WBGene00131492
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region