WormMine: Gene WBGene00131516

• WormBase Gene ID: WBGene00131516
• Gene Name: Cjp-nas-33
• Sequence Name: CJA12312
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable metalloendopeptidase activity and zinc ion binding activity. Predicted to be involved in molting cycle and proteolysis. Is an ortholog of C. elegans nas-33.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12312a.1	CJA12312a.1		[unknown]
Transcript:CJA12312b.1	CJA12312b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12312a	CJA12312a		[unknown]
CDS:CJA12312b	CJA12312b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1089541
• Remark: Cjp-nas-33, GAATATTCTCACGAAGCTACAGGATTTCGGCAGTGTTGCAAAGCAGTGGCAGGGGAGAGA, WBGene00131516
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region