WormMine: Gene WBGene00131621

• WormBase Gene ID: WBGene00131621
• Gene Name: Cjp-mab-10
• Sequence Name: CJA12417
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable transcription coregulator activity. Predicted to be involved in negative regulation of DNA-templated transcription. Predicted to be located in nucleus. Is an ortholog of C. elegans mab-10. In C. elegans, mab-10 is involved in several processes, including exit from mitosis; regulation of development, heterochronic; and regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12417.1	CJA12417.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12417	CJA12417		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074332
• Remark: Cjp-mab-10, CACGCATTCCGAAAGTATTCCGCCATCTACGGACGTTTTGACACCAAAAGAAAGCCACAC, WBGene00131621
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region