WormMine: Gene WBGene00131695

• WormBase Gene ID: WBGene00131695
• Gene Name: Cjp-parp-2
• Sequence Name: CJA12491
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable NAD+ ADP-ribosyltransferase activity. Is an ortholog of C. elegans parp-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12491a.1	CJA12491a.1		[unknown]
Transcript:CJA12491c.1	CJA12491c.1		[unknown]
Transcript:CJA12491b.1	CJA12491b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12491c	CJA12491c		[unknown]
CDS:CJA12491a	CJA12491a		[unknown]
CDS:CJA12491b	CJA12491b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1091577
• Remark: Cjp-pme-2, GTCTCCGGAATGGAAGAGATTCCACAAGAAACACGTCTTTTGTACGATGAATACGTAATG, WBGene00131695
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region