WormMine: Gene WBGene00131713

• WormBase Gene ID: WBGene00131713
• Gene Name: Cjp-efl-1
• Sequence Name: CJA12509
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable RNA polymerase II cis-regulatory region sequence-specific DNA binding activity and protein dimerization activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be part of transcription regulator complex. Is an ortholog of C. elegans efl-1. In C. elegans, efl-1 is involved in several processes, including embryonic digestive tract morphogenesis; negative regulation of Ras protein signal transduction; and negative regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12509a.1	CJA12509a.1		[unknown]
Transcript:CJA12509b.1	CJA12509b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12509b	CJA12509b		[unknown]
CDS:CJA12509a	CJA12509a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1077240
• Remark: Cjp-efl-1, AACCACGAACTGCACGATTTTGTGCGCAAGGAACGACAATTTATGGGCGGAGAAGAGCAT, WBGene00131713
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region