WormMine: Gene WBGene00131743

• WormBase Gene ID: WBGene00131743
• Gene Name: Cjp-irk-3
• Sequence Name: CJA12539
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable inward rectifier potassium channel activity. Predicted to be involved in potassium ion transport. Predicted to be located in membrane. Is an ortholog of C. elegans irk-3. In C. elegans, irk-3 is involved in short-term memory.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12539a.1	CJA12539a.1		[unknown]
Transcript:CJA12539b.1	CJA12539b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12539b	CJA12539b		[unknown]
CDS:CJA12539a	CJA12539a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074327
• Remark: Cjp-irk-3, TGGTGATAATGAATGAGAAGCTCTCAAAATATGAAGTTCAATATTCTCTGTTCGATCAGA, WBGene00131743
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region