WormMine: Gene WBGene00132150

• WormBase Gene ID: WBGene00132150
• Gene Name: Cjp-prpf-4
• Sequence Name: CJA12946
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans prpf-4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12946d.1	CJA12946d.1		[unknown]
Transcript:CJA12946c.1	CJA12946c.1		[unknown]
Transcript:CJA12946b.1	CJA12946b.1		[unknown]
Transcript:CJA12946a.1	CJA12946a.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12946a	CJA12946a		[unknown]
CDS:CJA12946c	CJA12946c		[unknown]
CDS:CJA12946b	CJA12946b		[unknown]
CDS:CJA12946d	CJA12946d		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1076881
• Remark: Cjp-prpf-4, GCATGATTGCGTTGGATCCGAACAAGCGAATCACTTGTACAGAGGCTCTCAAACATCCAT, WBGene00132150
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region