WormMine: Gene WBGene00132165

• WormBase Gene ID: WBGene00132165
• Gene Name: CJA12961
• Sequence Name: CJA12961
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in intermediate filament cytoskeleton organization. Predicted to be located in cytoskeleton.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12961c.1	CJA12961c.1		[unknown]
Transcript:CJA12961b.1	CJA12961b.1		[unknown]
Transcript:CJA12961a.1	CJA12961a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12961b	CJA12961b		[unknown]
CDS:CJA12961a	CJA12961a		[unknown]
CDS:CJA12961c	CJA12961c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1071085
• Remark: CJA12961, ATCACAGAATACGAAGACTCGGAGAAGCAGAGACAATCTGTGCCAAAGTTCCGCGAATCG, WBGene00132165
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region