WormMine: Gene WBGene00132652

• WormBase Gene ID: WBGene00132652
• Gene Name: Cjp-srf-3
• Sequence Name: CJA13448
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable pyrimidine nucleotide-sugar transmembrane transporter activity. Predicted to be involved in pyrimidine nucleotide-sugar transmembrane transport. Predicted to be located in Golgi membrane. Is an ortholog of C. elegans srf-3. In C. elegans, srf-3 is involved in UDP-N-acetylglucosamine transmembrane transport and UDP-galactose transmembrane transport.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA13448a.1	CJA13448a.1		[unknown]
Transcript:CJA13448b.1	CJA13448b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA13448a	CJA13448a		[unknown]
CDS:CJA13448b	CJA13448b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1089370
• Remark: Cjp-srf-3, ATACGCTGACAATATTGCTAAAAATTTTGCGACATCCGTGGCCATTGTGCTCTCCACAAT, WBGene00132652
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region