WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00132753 Gene Name  Cjp-syd-1
Sequence Name  ? CJA13549 Organism  Caenorhabditis japonica
Automated Description  Predicted to be involved in signal transduction. Is an ortholog of C. elegans syd-1. In C. elegans, syd-1 is involved in several processes, including axo-dendritic transport; cell projection organization; and locomotion. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA13549b.1 CJA13549b.1   [unknown]
Transcript:CJA13549a.1 CJA13549a.1   [unknown]
Transcript:CJA13549c.1 CJA13549c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA13549c CJA13549c   [unknown]
CDS:CJA13549b CJA13549b   [unknown]
CDS:CJA13549a CJA13549a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-syd-1, ATTGTCAGCGAAAAATTGTCTGCTTCTTGTCCTCGATCATTTGAGTACAATTCTATCTTC, WBGene00132753   Expr1081919 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA20494, TTGACGAGATTGATTCAAGAAATTGAGAAGAGAGGAGTGGATTGCATGTTCCTTTACGTT, WBGene00176066   Expr1082676 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  involved_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region