WormMine: Gene WBGene00132841

• WormBase Gene ID: WBGene00132841
• Gene Name: Cjp-gon-1
• Sequence Name: CJA13637
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable metalloendopeptidase activity. Predicted to be involved in extracellular matrix organization and proteolysis. Is an ortholog of C. elegans gon-1. In C. elegans, gon-1 is involved in several processes, including endoplasmic reticulum to Golgi vesicle-mediated transport; muscle organ morphogenesis; and negative regulation of presynapse assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA13637b.1	CJA13637b.1		[unknown]
Transcript:CJA13637a.1	CJA13637a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA13637b	CJA13637b		[unknown]
CDS:CJA13637a	CJA13637a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1075899
• Remark: Cjp-gon-1, GAAACCAAAGAAACAACAGAACGAGAGTGCAACCGTATTCCATGCCCCCGCTGGGTGTAC, WBGene00132841
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region