WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00132879 Gene Name  Cjp-gale-1
Sequence Name  ? CJA13675 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable UDP-glucose 4-epimerase activity. Predicted to be involved in galactose metabolic process. Is an ortholog of C. elegans gale-1. In C. elegans, gale-1 is involved in several processes, including gonad morphogenesis; negative regulation of endoplasmic reticulum unfolded protein response; and positive regulation of vulval development. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA13675.1 CJA13675.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA13675 CJA13675   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA23137, CCAAAATGTCGACGTTTGCGATGAGAAGGCGTTGGAGAAGGTGTTCGCCGAGAATAAATT, WBGene00178709   Expr1070830 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-gale-1, AAAAACTGGGCTGGAAGGCCGAGAATGGTCTCGAAGAGATGTGTGCTGATCTTTGGAATT, WBGene00132879   Expr1088182 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  involved_in
  enables

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region